Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0597
Clone ID AG0597
Vector pGT0lxr
Project sanger

Sequence tag AG0597
Sequence
ATGTCATCTTTGTATTTGGATTCAGAACGCAATTCGGTGGTGGCAAGACCACAGGCTTTGGCGTGATATATGATTTTTTA
GATTATGCAAAGAAGAATGAGCATAAACATAGACTGTCAAGACATGGCCTTTATGAGAAGAAAAAGACCTCCCGAAAACA
GCGAAAGGAACGCAAGAACAGAATGAAGAAGGTCAGGGGCACGGCGAAGGCCAATGTTGGTGCTGGCAAAAAG
Sequence Type mRNA
Unitrap ID UNI4938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 25311217..25312715 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025290 (Rps24) NM_011297 ribosomal protein S24 Gene [Source:MGI Symbol;Acc:MGI:98147]

 
Come back to gene ENSMUSG00000025290


For any suggestions or comments, please send an email to unitrap@crg.es