Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST283965
Clone ID OST283965
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST283965
Sequence
TGGCATGCGCTGGAGGCANAGCCCTATGATGACCTCCCNGGAGANACNGTGGNGANAACTGAGTTAATTCCTCNCCTGGN
TGGTGATGANAAAACCGNNAACTCAGAGTCCAAACAGAAACCCTGNTTAGACACTAGCCAGGCTGAAGGNNTCCCATNTT
NTAAACCAACACTCCTAGCCAATGGTGATCATGGAANGGAGGGGAATAACACTGCAGGGTCTCCAACTGACTTCCTTGAA
GAGAGAGTGGACTATCCGGATTATCAGAGCAGCCAGAACTGGCCAGAAGATGCAAGCTTTTGTTTCCAGCCTCAGCAAGT
GTTAGATACTGACCAGGCTGAGCCCTTTAACGAGCACCGTGATGATGGTTTGGCAGATCTGCTCTTTGTCTCCAGTGGAC
CTC
Sequence Type mRNA
Unitrap ID UNI5288

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109881449..109930243 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032479 (Mtap4) NP_032659 microtubule-associated protein 4 Gene [Source:MGI Symbol;Acc:MGI:97178]

 
Come back to gene ENSMUSG00000032479


For any suggestions or comments, please send an email to unitrap@crg.es