Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST283791
Clone ID OST283791
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST283791
Sequence
GACTGAGGTTTATGGTCNGCTGNGGGANAGTGATGACTGGTTTCATGGAAGACTGTGTTGGATTNANTCTTTCTCAAGCA
CAGNATATGGCTGAGGAAGACNANGAANATGTNTGTGTAAGGTGCTGTGCTGAAGAAGATAAAAAGACTGACTTACTAGA
CGCAGCAGATTTTTGAAGCCCAAGCTCCCATCGAAGCCCACAGCGAAGCATNAAAGGATGGAGTGTGGTAAGCTGACATC
ATCGAAGCACGCAGTCACTNGACGATAAACACAGACACTCAGATGACCCTGGGAAGCACAAGGTCAAAATTNTAAAACNG
NAGTCTGGTGAGGGAAAAACTTCCTCTGACAGTAGAGATAATGAAATTAAAAAATGGCAGCTAGCCCCTCTTCGCAAGTT
GAGCCAACCACATTTACCTCGGAGATCATCAGAAGAAAA
Sequence Type mRNA
Unitrap ID UNI20387

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 30878041..30881366 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048874 (Phf3) NM_001081080 PHD finger protein 3 Gene [Source:MGI Symbol;Acc:MGI:2446126]

 
Come back to gene ENSMUSG00000048874


For any suggestions or comments, please send an email to unitrap@crg.es