Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AP0656
Clone ID AP0656
Vector pGT0lxr
Project sanger

Sequence tag AP0656
Sequence
GGTTGTGAGCTCTTCTAGATGGTTTTTTTTCCTTGGGTCTCCACTGCTATACAGAGTCCCTGGCAGAGTCAGCCGCTGCC
TATACAAAGGCTACAGCGTGGACGTGTTTGCTGGAGAAGGTGGAGGTCATCACGGGGGAGGAGGCAGAGAGCAATGTGCT
GCAG
Sequence Type mRNA
Unitrap ID UNI4943

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56847563..56847703 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002372 (Ranbp3) NM_027933 RAN binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1919060]

 
Come back to gene ENSMUSG00000002372


For any suggestions or comments, please send an email to unitrap@crg.es