Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AN0930
Clone ID AN0930
Vector pGT0lxr
Project sanger

Sequence tag AN0930
Sequence
AAGTCTCCAGCAGCCGGGAGCACTTCGCTCTGCCTGCTGTGAGCTCACTTAACATATGCTAAGTCCTCCAGACCACAGGC
TAGGGCAAGAGGCTCATGTGGGTTGTGTTCCAGGAGGTGGCCAGGTGGAAGTAAAATCAGAGAAGCTGGACTTCAAGGAC
AGAGTCCAGTCGAAGATTGGCTCCTTGGATAATATCACCCACGTCCCTGGAGGAGGGAATAAGAAG
Sequence Type mRNA
Unitrap ID UNI4947

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104183629..104183854 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es