Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AN0926
Clone ID AN0926
Vector pGT0lxr
Project sanger

Sequence tag AN0926
Sequence
GGTTTTTTTTCAACCTTGTCCGCCGGTTGGCGCGGTCTCCATCACAGCGGCGACCGCTCCTGTTGCAGCTGTAGCTCTCT
CCCTTCGGTCCCTTCCCGCCAGGTCCCGGAGTTTCGCCCGCCATGGCTCTACTCACTGCAGCAACCCGGCTCTTGGGAGC
CAAG
Sequence Type mRNA
Unitrap ID UNI4248

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127774859..127775015 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005683 (Cs) NM_026444 citrate synthase Gene [Source:MGI Symbol;Acc:MGI:88529]

 
Come back to gene ENSMUSG00000005683


For any suggestions or comments, please send an email to unitrap@crg.es