Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST283516
Clone ID OST283516
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST283516
Sequence
GACTGAGCTCTGGCCAGATGGAGCCCAGCACCTCAACCAGGAAGCATTTCACCATCAATGACTTTGAAATCGGGCGTCCT
CTGGGCAGGGGGAAATTTGGGCGTGTGTACTTGGCTCGGCTCAAGGAAAATCATTTCATCGTGGCCCTGAAGGTCCTCTT
CAAGTCTGAGATAGAGAAGGAGGGATTGGAGCACCAACTTCGCAGGGAAGTGGAGATCCAGGCACACCTACAACACCGGA
ACATCCTTCGCCTGTACAACTACTTCTATGATGACACTCGGATATACTTAATTCTGGAGTATGCTCCAGGAGGAGAGCTC
TATAAGGAGCTTCAGAGACATCAGAAGTTGGACCAGCAGCGTACAGCCACGATAATACAGGAGTTGTCAGATGCCCTGAC
CTACTGCCATGAGAAGAAGGTGATTCACAGGGACATCAAGCCAGAGAATCTCCTGCTGGGCCTCAATGG
Sequence Type mRNA
Unitrap ID UNI18742

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 6948974..6952787 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070837 (Aurkc) NM_001080965 aurora kinase C Gene [Source:MGI Symbol;Acc:MGI:1321119]

 
Come back to gene ENSMUSG00000070837


For any suggestions or comments, please send an email to unitrap@crg.es