Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST283498
Clone ID OST283498
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST283498
Sequence
GACTGAGCTCCTCCAGAGTTCCTGATCTATGAAATGGCAGAGAATGGAAAAAATTGTGACCAGAGACGCATAGCAATGAG
TAAGGATCAGCACAATGGAAGTCTCACAGACCCCTCTTCAGTTCATGAGAAGAAGAGAAGGGATCGGGAAGAAAGACAGA
ATATTGTCCTGTGGAGACAGCCACTCATTACCTTGCAGTATTTCTCTCTGGAAACTCTTGTAGTTTTGAAGGAATGGACC
TCAAAATTGTGGCATCGTCAAAGCATTGTGGTGTCCTTTTTACTGCTGCTTGCTGCGCTTGTAGCTACGTATTATGTGGA
AGGAGCGCACCAACAGTATGTGCAGCGGATAGAGAAGCAGTTTCTTTTGTATGCATACTGGATAGGCCTGGGGATTTTGT
CCTCTGTTGGTCTTGGAACAGGACTGCACACCTTTCTGCTTTATCTGGGCCCACATATAGCTTCAGTTACATTAGCTGCT
TATGAATGCAATTCGGTGAATTTCCCT
Sequence Type mRNA
Unitrap ID UNI22837

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86457108..86479382 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018171 (Tmem49) NM_029478 transmembrane protein 49 Gene [Source:MGI (curated);Acc:Tmem49-001]

 
Come back to gene ENSMUSG00000018171


For any suggestions or comments, please send an email to unitrap@crg.es