Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST283303
Clone ID OST283303
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST283303
Sequence
GGACCTGGCGGCCTGTGGGTGTGGGGGGCCCCGGCTGTAGCTCAGCTGTTGTGGCCTGCAGGCCTGGGGGGACCCGGGGG
CAGCCGGGCAGCTGTCCTGGTCCAGCAGTGGGTCAGTTATGCTGACACGGAGCTCATACCCGCTGCCTGCGGGGCGACCC
TGCCTGCCCTGGGACTTCGAGGTCCTGGTCAGGATCCCCAGGTGAGAGGGAAGAAAAAGGGAGAAATTCTGACTACACAA
ACAGGATTGGGAAGAATCCCACGAAAAAAGTCGGTT
Sequence Type mRNA
Unitrap ID UNI22843

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35138575..35138850 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007029 (Vars) NM_011690 valyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:90675]

 
Come back to gene ENSMUSG00000007029


For any suggestions or comments, please send an email to unitrap@crg.es