Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AL0055
Clone ID AL0055
Vector pGT0lxr
Project sanger

Sequence tag AL0055
Sequence
AAGGAGGCCGGAGGGCGGGGAGCGTGAAGATAGGGGCAAGCTGCCGGAGTCGCCCAAGAGGGCTGAGGAGATCTGGCAGC
AGAGTGTCATCGGAGACTATCTGGCCCGCTTCAAGAATGACCGGGTGAAAGCCTTGAAAGCCATGGAGATGACTTGGAAC
AACATGGAGAAGAAGGAGAAGCTGATGTGGATTAAGAAGGCAGCAGAAGACCAAAAACGATATGAG
Sequence Type mRNA
Unitrap ID UNI4954

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102170013..102170319 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020923 (Ubtf) NM_001044383 upstream binding transcription factor, RNA polymerase I Gene [Source:MGI (curated);Acc:Ubtf-002]

 
Come back to gene ENSMUSG00000020923


For any suggestions or comments, please send an email to unitrap@crg.es