Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST282903
Clone ID OST282903
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST282903
Sequence
ATTTTGCTGAAGGCTGGCCTGNGACCTCNATGTGCAAGATGATGATNNTNANACACTGGACNTTGNAATGACAGCCNTGA
TAACNTGGANGCTGGNACTGATGTTACCTGNCTTNCTGNGTNCTNNCCATGCTTTGNACTATCTACNAGANTGCANATAA
ANNGCTTTATTATCATTNAAGAAGANCANACCTAACTATGAGTAGCCGTGTCCGAGCATGGCCGGACCCCCTTGCACCTC
GCTGCCAATAAGGGACATCTTTCTGNGGNGCAGATTTTGCTGAAGGCTGGCTGTGACCTCGATGTGCAAGATGATGATAT
AAAACACTGGACAATGTAATGACAGCGTGATAACTGGAGGCGGGACTGATGTTACCTGATTCCTGTGTACTAACCATGCT
TTGAAATATCTACAAGAATGCAAATAAATTGCTTTATTATCATTAAAAC
Sequence Type mRNA
Unitrap ID UNI22852

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 32921373..32923410 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040183 (Ankrd6) NM_001012450 ankyrin repeat domain 6 Gene [Source:MGI (curated);Acc:Ankrd6-002]

 
Come back to gene ENSMUSG00000040183


For any suggestions or comments, please send an email to unitrap@crg.es