Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST282889
Clone ID OST282889
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST282889
Sequence
AGACAAGAAGTGGNTNNAGNANACACAACAGAAGATGCAAAATNCNCNGNATAGTTTNTNCTNNAGNNGCACCTTGGAAA
AGAGAATTGAAGATCTTGAAAAGGAAGTTGTAAGAGAAAGGCAAGAAAACCTTNNACTTGNGAGGCTGATGCAAGATAAA
GAAGAAATGATTGGGAAACTCAAGGAAGAGATCGATTTGTTAAATAGAGACCTAGATGACATGGAAGATGAGAACGAGCA
ACTAANACAGGAAAATAAAACTCTTTTGAAGGTTGTTGGGCA
Sequence Type mRNA
Unitrap ID UNI22853

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 107846567..107850797 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035873 (Pawr) NM_054056 PRKC, apoptosis, WT1, regulator Gene [Source:MGI Symbol;Acc:MGI:2149961]

 
Come back to gene ENSMUSG00000035873


For any suggestions or comments, please send an email to unitrap@crg.es