Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST282402
Clone ID OST282402
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST282402
Sequence
AACTGAGGTCCGCTGCAGACACAACCACCAAGTTTGTCTGGACAGCCACCTATGTACTCTGGGACCTTGGACTGTTTCCG
GAAGACTCTTATGAGAGAGGGCATCACAGGGCTGTATCGGGGCATGGCCTGCGCCCATCATTGGAGTCACCCCTATGTTC
GCCGNGTGCTTCTTTGGGTTTGGTCTGGGGAAGAAACTACAGCAGAAATCTCCAGAGGATGAACCTTAGCTACCCACAGC
TGTTTACAGCTGGGATGTTATCTGGTGTGTTCACCACAGGAATCATGACCCCTGGAGAACGGATCAAATGCTTACTGCAG
ATTCAGGCTTCTTCAGGGGAGAACAAGTACAGTGGCACCTTGGACTGCGCAAAGAAGCTGTATCAGGAGTTCGGGATCCG
CGGCTTCTACAAAGGGACTGTGCTCACACTCATGCGAGATGTTCCTGCCAGTGGGATGTATTTCATGACATATGAATGGC
TTAAAAATCTCTTCACTCCAGAGGGAAAGAGTGTCAGTAA
Sequence Type mRNA
Unitrap ID UNI7651

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108572095..108584375 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032602 (Slc25a20) NM_020520 solute carrier family 25 (mitochondrial carnitine/acylcarnitine translocase), member 20 Gene [Source:MGI Symbol;Acc:MGI:1928738]

 
Come back to gene ENSMUSG00000032602


For any suggestions or comments, please send an email to unitrap@crg.es