Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST282148
Clone ID OST282148
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST282148
Sequence
ACTGAGGAGCTGGCTAGGAGACGCCCCATGGCAGTAGGCAACATCAACGAGCTGCCAGAGAACATCCTGCTGGAACTGTT
CATCCACATCCCAGCTCGCCAACTGCTGCTGCGCTGNCGACCCGNCTGCAGCCTCTGGCGAGACCTCATTGACCTGGTTA
CACTCTGGAAGCAGCAAGNGCCTTCAAGAGGGCTTCATCACCGAGGACCTGGGACCAGCCTGTGGCTGACTGGAAGATNT
TCTACTTCCTGCGCAGCCTCCAGAGGAACCTNCTTCACAACCCTTGTGCTGAAGAGGGATNNGAGTTCTGGAGCCTGGAT
GTGAATGGAGGCNATGAATGGAAGGAGGNGGATCTCTCTAAAGACCAGCGAANGGAATTCCCCAATGACCAGGTCA
Sequence Type mRNA
Unitrap ID UNI22881

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147530714..147532934 267
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029001 (Fbxo44) NM_173401 F-box protein 44 Gene [Source:MGI (curated);Acc:Fbxo44-001]

 
Come back to gene ENSMUSG00000029001


For any suggestions or comments, please send an email to unitrap@crg.es