Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST282137
Clone ID OST282137
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST282137
Sequence
ACTGAGAAGAGGTGGAGGATGCGAGTGAAGAGGCTCCCCTGAGGGACCGCTCCCACATTGACAAAACCCTGATGCTGAAT
GAGGACAAGCCAGCTGACGATTACTCAGCGGTGCTGCAGCGACTTCGGAAGATCTATCATACGTCCATCAAGCCCCTGGA
GCAGTCTTACAAGTACAATGAGCTTCGGCAGCATGAGATCACAGACGGGGAGATTACTTCCAAGCCAATGGTGCTGTTCC
TGGGACCGTGGAGTGTTGGCAAATCCACCATGATAAACTACCTCCTTGGGTTAGAAGATACTCGATACCAACTTTATACA
GGTGCTGAACCTACCACCTCTGAGTTCACTGTCCTTATGCATGGGCCCAAGCTGAAAACCATTGAGGGCATCGTCATGGC
TGCTGATAGTGCCCGATCCTTCTCACCACTGGAAAAGTTTGGCCANAATTTTNTGNAAAAGCTGATTGGCATTGAGGTTC
CCCACAAGCTTCTAAAACGCA
Sequence Type mRNA
Unitrap ID UNI22883

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4486333..4493882 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022519 (Srl) NM_175347 sarcalumenin Gene [Source:MGI (curated);Acc:Srl-001]

 
Come back to gene ENSMUSG00000022519


For any suggestions or comments, please send an email to unitrap@crg.es