Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST281463
Clone ID OST281463
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST281463
Sequence
GCTAATGCATTTGAGAAAACGATAAANATTGGCGGGTAGGGAAAAAAGCAACGTGTTTCTGCAACTTTGCTGGATGNTAA
GATGTCTGTGGACATGAACAGCCATGGGTCATGATAGCAATGAAGAGGACTATGACCCAAACTGTGAGGAAGAGGAAGAA
GAGGAAGAGGACCCTGGGGACATAGAGGACTACTATGTGGGAGTAGCCAGTGATGTGGAGCAGCAGGGGGCTGATGCTTT
TGATCCTGAAGAGTATCAGTTCACTTGCTTGACCTATAAGGAGTCTGAGGGCGCCCTCCATGAACATATGACCAGCTTAG
CCTCTGTCTTAAAGGTGAGTTGTTCTGCCAGTTCAAATGTAATCTCTCAGGTGAAACTGA
Sequence Type mRNA
Unitrap ID UNI11641

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108546311..108546687 362
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064145 (Arih2) NM_011790 ariadne homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1344361]

 
Come back to gene ENSMUSG00000064145


For any suggestions or comments, please send an email to unitrap@crg.es