Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST281449
Clone ID OST281449
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST281449
Sequence
GGTCCATGCTGACTTCCCACTAATTCACCTAAAAGACTGCAGTTCCTGGAAATGAAACCATTCTGCCATTGACTTTCGCA
TCCTAGTGCCTATAAAAGATGTTTAAATGTTCGTTGGCTTTAAGTGGATGCTTAAGTGAACAGTGTGTTTCTGGCCCAAC
TATGTCAAGTCTTTCTTCACTAAGTACTCCACCCATGAAGGATTCAGCTCTCATCAGAAACCCATGAGCACCCATCAGAC
CTCGGCATAACTTAGACGACAGAGGAGAAAAATCGGAAGCCCTGGGCAGCATTGCACTTGACAAATATGGGCCTCAAAAC
AAACAAAA
Sequence Type mRNA
Unitrap ID UNI22139

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 57088995..57089322 326
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054181 (A930012O16Rik) RIKEN cDNA A930012O16 gene Gene [Source:MGI Symbol;Acc:MGI:2442255]

 
Come back to gene ENSMUSG00000054181


For any suggestions or comments, please send an email to unitrap@crg.es