Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AC0576
Clone ID AC0576
Vector pGT0lxr
Project sanger

Sequence tag AC0576
Sequence
CTCTTCAAGATGGTGGTTGTGACCTCTTCTAGATGGTGGTTGTGAGCTCTTCTAGATGGTATGGGTTGCCTGAAGTTTGA
TGAGGAGCGAGCCCAG
Sequence Type mRNA
Unitrap ID UNI4967

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107718450..107718491 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031885 (Cbfb) NM_022309 core binding factor beta Gene [Source:MGI Symbol;Acc:MGI:99851]

 
Come back to gene ENSMUSG00000031885


For any suggestions or comments, please send an email to unitrap@crg.es