Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XS0995
Clone ID XS0995
Vector pGT0lxf
Project sanger

Sequence tag XS0995
Sequence
CTTCTAGATGGTTTTTTTTTAATGGTGATCCAGATGAAGTCCGAGCACTAATATTTAAGAAAGAAGATGTTAACTTTCAG
Sequence Type mRNA
Unitrap ID UNI4402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32592108..32592170 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014496 (Ankrd28) NM_001024604 ankyrin repeat domain 28 Gene [Source:MGI Symbol;Acc:MGI:2145661]

 
Come back to gene ENSMUSG00000014496


For any suggestions or comments, please send an email to unitrap@crg.es