Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST281246
Clone ID OST281246
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST281246
Sequence
GACTGAGTGTCGCAGCCCCAGGCTGCTCATGCCCCACTGGGAGAAGCCGGCCAGCACTGCGATCCTGTGTAATACCTGTG
GGAATGTGTGCAAGGGAGAGGTGCTGCGTGTGCAGAACAAGTACTTCCACATCAGGTGCTTTGTGTGCAAAGCGTGTGGC
TGTGACCTGGCTGAGGGTGGCATTCTTCGTGAGGCAGGGTGAGCACATTTGCACACGTGACTACCAGCGGCTCTATGGCA
CTCGCTGCTTCAGCTGTGACCGCTTCATTGAAGGCGAAGTGGTGTCGGCGCTTGGGAAGACCTACCACCCTGACTGCTTC
GTGTGTGCTGTCTGCAGGCTGCCCTTTCCTCCTGGGGACCGTGTGACCTTCAACGGGAAGGAGTGTATGTGCCAGAAGTG
TTCCCCACCCACATTGCTGGGCAACAGTGCTCACGTGGCCCAGGGCCTCCGGAGTAAGGGNGACCGGCATCTTCTTTGAN
CACGANTACTAACAAACTGGAACG
Sequence Type mRNA
Unitrap ID UNI22918

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 36141100..36149853 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029095 (Ablim2) NM_177678 actin-binding LIM protein 2 Gene [Source:MGI (curated);Acc:Ablim2-007]

 
Come back to gene ENSMUSG00000029095


For any suggestions or comments, please send an email to unitrap@crg.es