Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST281081
Clone ID OST281081
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST281081
Sequence
TCCCCACTTCCAGTGCTGCACGCACATTGGTNCACGGTCCTCTGTGGTNCTACTGATGCCCCTCACCCANTGTCGATGAT
CCNCGGTNGNCGAGGNNGCGGNAGGGATCCTTCTCTCTCAGCTCTAATATATNANGACGANANGCTCACTGTANCCCAGG
ACCTCCCCGTGAACGATGGANAACCTCACATCGTCCACTTCCAGTATGAGGGTCACCGAGGNGAANGTCTCTTCCTGGGA
TGCAGTCCTGTCCAGCCAGAGCCTGTTTGTAGAAATCCCAGATGGATTATTAGCTGATGGGAGCAAAGAAGGATTATTAG
CACTGCTAGAGTTTGCTGAGGAGAAGATGAAAGTGAACTACGTCTTCATCTGCTTCAAGAAGGGCCGGGAAGACAGAGCT
CCACTCCTGAAGACGTTCAGCTTCTTGGGCTTTGAGATTGTGCGTNCAGGNCATTCCTGTGTCCCCT
Sequence Type mRNA
Unitrap ID UNI18135

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65534027..65536970 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040652 (Oaz2) NP_035082 ornithine decarboxylase antizyme 2 Gene [Source:MGI Symbol;Acc:MGI:109492]

 
Come back to gene ENSMUSG00000040652


For any suggestions or comments, please send an email to unitrap@crg.es