Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST281012
Clone ID OST281012
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST281012
Sequence
CCCCCATAGGGAAGAGAAATGGCCCCAGGGATTTGGTCAGCTAACCAAGGAAGGGATGCTACAGCACTGGGAGCTGGGCC
AGGCCCTGCGGCAACGCTACCATGGCTTTCTGAACACCTCTTACCACAGGCAAGAGGTTTATGTGCGAAGCACAGACTTC
GATCGTACTCTCATGAGTGCTTGAGGCCAACCTGGCTGGACTCTTCCCTCCCAATGAAGTTCAGCACTTCAACCCTAACA
TTTCATGGCAGCCTATCCCTGTTCACACTGTGCCCATCACTGAAGACAGGTTGCTGAAGTTTCCTTTGGGTCCATGTCCC
CGTTATGAGCAGCTGCAGAATGAGACTCGGCAGACACCAGAGTATCAGAAACAGAAGTATTCAGAATGCACAATTTCTGA
ACATGGTGGCCAACGAGACAGGGCTTACAAACGTGACCCCTAGAGACCATCG
Sequence Type mRNA
Unitrap ID UNI22928

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91043805..91046404 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002103 (Acp2) NM_007387 acid phosphatase 2, lysosomal Gene [Source:MGI (curated);Acc:Acp2-001]

 
Come back to gene ENSMUSG00000002103


For any suggestions or comments, please send an email to unitrap@crg.es