Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST280939
Clone ID OST280939
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST280939
Sequence
ATGCATCAATCCTCTTGGGACTGTTATCAGATGTTTGGAGGCCATGATTAAATACCTTACACTGTGGAAGAAAGAGGGGC
AGGAGGAGCCATATGTCAGCCTCACCCGAAAGAAGATGCTAATAGCTGGCCAGGAGGTGCTGATAGAATGGGAGGTGGGC
CACCTCCATCCGGACCCTGGCTATGCATCGCAATGCCTACAAACCTGTGTTAATGGCTTTTTCCCTGATATCTGTCACCT
ACGGGGCTACCCTGTGCAATATGTTGGCTATCCAGATCAAGTATGATGACTACAAGATTAGACTGGGGCCACTGGAAGTC
CTTTGTATCACCGTCTGGAGGACATTGGAGATCACTTCCCGCCTCGTGATTCTGGTGCTCTTCTCGGCCCACCTTGAAGT
TGAAGGCTGTGCCCCTTCTTAGTGCTCAACTTCTTGATCATCCTCTTTGAGCCCCTGGGTCAGGTA
Sequence Type mRNA
Unitrap ID UNI22932

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 130685578..130692023 247
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031258 (Xkrx) NM_183319 X Kell blood group precursor related X linked Gene [Source:MGI (curated);Acc:Xkrx-001]

 
Come back to gene ENSMUSG00000031258


For any suggestions or comments, please send an email to unitrap@crg.es