Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AE0499
Clone ID AE0499
Vector pGT0lxr
Project sanger

Sequence tag AE0499
Sequence
TTTTTCTGTGACTGTGGAGCCAAGGAAGATGGCAGCTGCTTGGCCCTGGTGAAGCGAACTCCTAGCAGTGGCATGAGCTC
TACCATGAAGGAGTCAGCATTTCAGAGCGAACCTAGGGTTTCCGAAAGTCTGGTGCGCCATGCCAGCACCTCTCCTGCTG
ACAAGGCCAAGGTCACCATCAGTGATGGGAAGGTTACAGATGAAGAGAAGCCCAAGAAGAGCAGCCTGTGCCGTACAGTT
GAGGGGTGTCGTGAGGAGCTGCAGAATCAGGCCAATTTCTCCTTCGCTCCTCTCGTGTTAGACATGCTCAGTTTCCTCAT
GGATGCCATTCAGACCANCTTTCAGCANGCTTCAGCCGNTGGGATGCANCATCNNGNCCCNGNTGGNCCTNACTNATTCT
ACACNGGTGGTTGNNAGCTCTTCTAGATGGCAGACCAGCTGATG
Sequence Type mRNA
Unitrap ID UNI4331

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 138977252..138978478 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066036 (Ubr4) ubiquitin protein ligase E3 component n-recognin 4 Gene [Source:MGI (curated);Acc:Ubr4-001]

 
Come back to gene ENSMUSG00000066036


For any suggestions or comments, please send an email to unitrap@crg.es