Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST280774
Clone ID OST280774
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST280774
Sequence
GAGGACCTGTATCAAGTGCAACAAAGGTATCTATGGGCAGAGCAATGCCTGCCAGGCCCTGGACAGCCTCTACCACACCC
AGTGCTTTGTCTGCTGCTCCTGTGGACGAACTTTGCGGTGCAAGGCTTTCTACAGCGTCAATGGCTCTGTCTACTGTGAG
GAAGACTATCTGTTTTCAGGGTTTCAGGAGGCAGCTGAGAAGTGCTGTGTCTGTGGCCACTTGATTCTAGAGAAGATCCT
CCAGGCCATGGGGAAGTCCTATCACCCGGGCTGCTTCCGATGCATCGTATGTAACAAGTGCCTGGACGGCGTCCCCTTCA
CTGTGGACTTCTCCAACCAGGTGTACTGTGTTACCGACTACCACAAAAATTACGCCCCGAAATGTGCAGCCTGCGGACAA
CCCATCCTCCCCTCAGAGGGCTGTGAGGACATTGTGAGGGTGATATCCATGGACCGTGATTATCACTTTGAGTGCTACCA
CTGTGAGGACTGCCGAAAAAA
Sequence Type mRNA
Unitrap ID UNI15057

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55188312..55192328 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022178 (Jub) NM_010590 ajuba Gene [Source:MGI Symbol;Acc:MGI:1341886]

 
Come back to gene ENSMUSG00000022178


For any suggestions or comments, please send an email to unitrap@crg.es