Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XS0954
Clone ID XS0954
Vector pGT0lxf
Project sanger

Sequence tag XS0954
Sequence
AGAATGCGTTTACCTTGCTTGTGGAGATGGGCCATGCTTTCATGCGATTTGGCTCCAACCAGGAAGACGCTCTGCAGCGG
TACCTTGTCCTCATCTATCCTGGCCTTCTGGGTGCAGTTACCACAGTTAGTTACAGCATTTGTGCTCTGACCCACCTC
Sequence Type mRNA
Unitrap ID UNI4970

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 41948249..41948791 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035049 (Rrp12) NM_199447 ribosomal RNA processing 12 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2147437]

 
Come back to gene ENSMUSG00000035049


For any suggestions or comments, please send an email to unitrap@crg.es