Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST280698
Clone ID OST280698
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST280698
Sequence
GACTGAGCTGTGGACAACTATTTTCATCTGGCAGTTGCCTTTATCACTCAGGACTCTCTGCAGCTGGAGCAGTTCACACA
CGCTAAGTACAACAAAATCCTGAATAAGTACCGGGGACATGAGACGGCTCATAGGATTCTCCATCCGTGATATGTGGTAC
AAGCTTGNGCAGAGCGNATGCTGAGAGNTTTCTGCATCATGGCTGACA
Sequence Type mRNA
Unitrap ID UNI22940

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 34194110..34194361 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020143 (Dock2) NP_203538 dedicator of cyto-kinesis 2 Gene [Source:MGI (curated);Acc:Dock2-001]

 
Come back to gene ENSMUSG00000020143


For any suggestions or comments, please send an email to unitrap@crg.es