Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST280588
Clone ID OST280588
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST280588
Sequence
GTGGAAGAACGGGTGATCAACGAGGAGTACAAAATATGGAAGAAGAACACCCCTTTTCTTTATGATTTGGTGATGACCCA
TGCCCTGGAGTGGCCCAGCTTAACTGCCCAGTGGCTTCCAGATGTGACCAGGCCTGAAGGGAAAGATTTCAGCATTCATC
GGCTTGTCCTGGGAACACACACATCTGATGAACAGAACCACCTGGTGATTGCCAGTGTCCAGCTCCCTAATGATGATGCT
CAGTTTGATGCATCCCATTATGACAGTGAAAAAGGAGAATTTGGAGGTTTTGGTTCTGTCAGTGGGAAAATTGAAATAGA
AATCAAGATCAACCATGAAGGAGAAGTGAACAGGGCCCGNTNCATGCCTCAGAACCCCTGCATCATTGCAACAAAAGACT
CCATCCAGTGATGTNCTTGTTTNTGACTACACAAAGCACCNTTCTAAACCAGACCCTTCTGGAGAATTGCAACCCCGATT
TGCGTTAAAAT
Sequence Type mRNA
Unitrap ID UNI10890

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 128999681..129011871 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057236 (Rbbp4) NM_009030 retinoblastoma binding protein 4 Gene [Source:MGI (curated);Acc:Rbbp4-001]

 
Come back to gene ENSMUSG00000057236


For any suggestions or comments, please send an email to unitrap@crg.es