Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST280585
Clone ID OST280585
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST280585
Sequence
ACTGAGGAGACGTGTTTGCTGGGCAGTCAAAGGTCTATGCCTACATGAGTCCGAACAAGTGCTCTGCAATGCGCTCTCCA
CTTCAGGAAGAGAACTCGGTTGCCCATCATGAGGTCAAATGCCCGGNGAAACCATTAGCTGGAATCTACAGGAAGCTGAG
AAGAGANAAGGANCACNTGGTAACGTTATACCGAAGCTGCTGTGAAGTCAGATGAACAGAAGAGCAAAGACACCAGGAGA
GGTCCCCTGGCGCCTTTTCCAAACCAAAAATCCGAAGCAGCAGAACCTCCAAAAACTCCACCCCCATCATGTGATTCTAC
CAATGTAGCAGTCGCTAAGCAAGCCCTGAAAAAGTCCCTCAAGGGCAAACAGGCCCCTCGGAAAAAGTCTCAAGGGAAAA
CCCAGCAGAATAGAAAACTCACAGATTTCTACCCTGTGCGGAGGAGTTCCCGGAAGAGCAAAGCTGAGCTGCAGTCTGAA
AAAA
Sequence Type mRNA
Unitrap ID UNI17985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124897221..124901382 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049327 (Setd8) NM_030241 SET domain containing (lysine methyltransferase) 8 Gene [Source:MGI (curated);Acc:Setd8-001]

 
Come back to gene ENSMUSG00000049327


For any suggestions or comments, please send an email to unitrap@crg.es