Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST280583
Clone ID OST280583
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST280583
Sequence
AGCTGCGGCAGCATGGATCTACCGGTGGATGAATGGAAGTCCTACCTACTTAAGAAGTGGGCTTCACTCCCGAAGTCTGT
GCAGGACACAATTTCTACAGCAGAGACTTTGAGCGACATCTTCCTTCCTTCTTCTTCCCTTCTTCAACCTGAGGATGNGA
TGTNCNTGAAGGAACTNTCNANNAGNTACTCAGGTGNAAAAGGACAATGANGCTCCCCTCTTGTACAGAGANGAAGGAAN
CAGGAAANNCCAAGAAAAGGAGTACACAGATGCTGCAGAGCTGAACTCTAAGGNAGCCNNGCGTGCAACCAGCANTGGAA
CANGGCANNNANATGGAGGCTNAAGAGCNNACTCATAACCAGANCATCGTGCNGCTTNTGNCNANCAGGNNTGGGTNCTT
NTNCTNANANGATTCTTGGNTATGTNAAGTTGATGAATGAAGNTAANCANCACAGAGCTATTCNGGANTGAAAAACCAAA
TGTG
Sequence Type mRNA
Unitrap ID UNI19959

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75163171..75195978 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018809 (Smyd4) NP_001096081 SET and MYND domain containing 4 Gene [Source:MGI (curated);Acc:Smyd4-001]

 
Come back to gene ENSMUSG00000018809


For any suggestions or comments, please send an email to unitrap@crg.es