Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST280520
Clone ID OST280520
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST280520
Sequence
GACTGAGCTGTGATGCAGATCCATCAGCCCTAGCAAAATATGTTTTGGCTCTGGTAAAGAAAGACAAAAGTGAAAAAGAA
TTAAAGGCCGTTATGCATTGATCAGCATTGATGTATTTCTTCAGAAAGAGACACANATATTTGTTGAAAAACTTTTTGAT
GCTGTGAATACAAAGAGTTATCTACCTCCTCCAGAGCAGCCATCGTCAGGAAGCCTGAAGGTAGACTTTCTTCAGCACCA
AGAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI1066

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 105559073..105559193 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022119 (Rbm26) NM_134077 RNA binding motif protein 26 Gene [Source:MGI Symbol;Acc:MGI:1921463]

 
Come back to gene ENSMUSG00000022119


For any suggestions or comments, please send an email to unitrap@crg.es