Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XS0836
Clone ID XS0836
Vector pGT0lxf
Project sanger

Sequence tag XS0836
Sequence
CAATGGGCTGGTCCAGCGCGGAAAAGACAGCAAGCAATATGACTAAAAAGAAGCGGGAGAATCTTGGTGTCGCTCAGGAG
Sequence Type mRNA
Unitrap ID UNI4977

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29853879..29853957 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024018 (1110021J02Rik) RIKEN cDNA 1110021J02 gene Gene [Source:MGI Symbol;Acc:MGI:1915847]

 
Come back to gene ENSMUSG00000024018


For any suggestions or comments, please send an email to unitrap@crg.es