Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC1451
Clone ID GC1451
Cell line E14Tg2A.4
Vector pFlip1
Project tigem
Note NULL

Sequence tag GC1451
Sequence
AGATATCCATGTCATCTAGGTCATAGCGGCATGTAGATGCTGCT
Sequence Type mRNA
Unitrap ID UNI408

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 20066936..20066979 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037315 (Phf16) NM_199317 PHD finger protein 16 Gene [Source:MGI (curated);Acc:Phf16-001]

 
Come back to gene ENSMUSG00000037315


For any suggestions or comments, please send an email to unitrap@crg.es