Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSE536
Clone ID CSE536
Vector pGT0Lxf
Project baygenomics

Sequence tag CSE536
Sequence
CCACGGCAAAGACACCCATCAGTGTTAAGTGAAGATCCCTTTTTATTTGGGATTTTGATTTTTTTTTTGGTCTTACATTA
TATTTTTATAGATTTTGTTATAATCATGGTGCTGGGAAAGGTAAAGAGTTTGACAATAAGCTTTGACTGTCTTAATGACA
GTAATGTCCCCGTGTATTCTAGCGGGGACACTGTCTCAGGAAGGGTAAATTTAGAAGTTACCGGGGAGATCAGAGTAAAA
TCTCTTAAAATTCACGCAAGAGGACATGCGAAAGTACGGTGGACGGAATCAAGAAACGCCGGCTCCAATACTGCCTATAC
ACAGAATTACACTGAAGAAGTAGAATATTTCAACCATAAAGACATCTTAATTGGGCACGAAAG
Sequence Type mRNA
Unitrap ID UNI1733

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 81022807..81023188 368
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074794 (Arrdc3) NM_001042591 arrestin domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2145242]

 
Come back to gene ENSMUSG00000074794


For any suggestions or comments, please send an email to unitrap@crg.es