Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST279645
Clone ID OST279645
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST279645
Sequence
TACCTGCCTCATGTGGCGCGCCTNTGCCTGATCAGCACCTTCCTGGAGGANGGCATCCGCATGGGGGTCCAGANNAGCGA
GCAGNGNGACTATATCNACACCACCTGGAGCTGTGNCTACCNGTTGACCTCATCCTTCGAGNNNCTCAACCTGNTGNGAC
AATCGACTGGCACGTGTNTTGGNGCTGAGCAGGAACTTCGTGCAGTATGCCTGCTTTGGGCTGTTTGGAATCATCGCACT
GCAGACAATTGCCTATAGCATTTTGTGGGACTTGAAGTTTCTCATGAGGAACCTGGCTTTAGGAGGAGGTTTGCTGCTGC
TCTTGGCAGAATCCCGCTCAGAAGGGAAGAGCATGTTTGCTGGTGTCCCAACCATGCGTGAGAGCTCCCCCAAGCAGTAC
ATGCAGCTTGGAGGAAGGGTCCTGCTGGTCCTGATGTTCATGACCCTCCTTCACTTTGATGCCAGCTTCTTTTCTATCGC
Sequence Type mRNA
Unitrap ID UNI22979

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26779865..26782454 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014867 (Surf4) NM_011512 surfeit gene 4 Gene [Source:MGI (curated);Acc:Surf4-001]

 
Come back to gene ENSMUSG00000014867


For any suggestions or comments, please send an email to unitrap@crg.es