Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST279636
Clone ID OST279636
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST279636
Sequence
GAGCTTGTGGGAGTTGGCTGGCTCTGGGGACGAGCTGTTGGCAGTGCAGGTGGCTGGCGACAAGGATGGAGTGTGAGGCC
TCGAGACAGGATGGCAGGCAGCACAGAAGCCTCCGCACTCAGCAGAGCTGCGGTCCTGGCTGCTCTGAGGATNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGAGTGCTGGGAATCAACCTTGGAACC
TCTGGAAAAAGCGGCGAGTCAACCACAACCCATCGCTCAAGCCCCATTGCTGGGCCTGGTGACAACGCATGTCAGTCCTG
CCTCAGCCCCCTGAATGCATGTTTACAGATGTGCACCAGAGCACCTGACTCAAGTTTTAAACGATCATTTTGAGCACTNC
TTNTNATGGCCATTTCCCTGTAAATCAGCAGAGACACTGGGGNAATGGAGCAGTTTGACTCCCATGGCTGCTGGAGTCTC
CTTTACTGCCCCGTCTGTCTTG
Sequence Type mRNA
Unitrap ID UNI22980

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 96813893..96821218 280
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078700 (D030028A08Rik) RIKEN cDNA D030028A08 gene Gene [Source:MGI Symbol;Acc:MGI:2441931]

 
Come back to gene ENSMUSG00000078700


For any suggestions or comments, please send an email to unitrap@crg.es