Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST279629
Clone ID OST279629
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST279629
Sequence
AGCAAAAATGCCTACAGTAGNCTGAGNGGATGCATTGAGTCCCTGATTGCTGTTTTCCAAAAGTACAGCGGGAAGGATGG
AAACAACACTCAACTCTCCAAAACTGAATTCCTTTCCTTCATGAACACAGAGCTGGCTGCCTTCACAAAGAACCAGAAGG
ATCCTGGTGTCCTTGACCGCATGATGAAGAAGCTGGACCTCAACTGTGACGGGCAGCTAGATTTCCAAGAGTTTCTCAAC
CTCATTGGTGGCTTAGCTATAGCGTGCCATGATTCTTTCATCCAAACTTCCCAGAAGCGAATCTAATCCTCTTAGTTTCC
ATCCAACCACCAAGTCATCACCTCCCCCAACCCCATCCACACCTGCACTGAGCCCAGCACACCTACCACAACATGTATCC
CACGCCTGCTGGCGAAAATAAAACAATGCCATTTTTTTTTAAATGTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI22984

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 93327974..93330210 293
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027907 (S100a11) NM_016740 S100 calcium binding protein A11 (calgizzarin) Gene [Source:MGI (curated);Acc:S100a11-001]

 
Come back to gene ENSMUSG00000027907


For any suggestions or comments, please send an email to unitrap@crg.es