Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST279560
Clone ID OST279560
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST279560
Sequence
TCTGAGGGCTCCTCCCACCTCCCTCAANAGNTCANGTTCACCACCTCCGACTNCTGTGACCGCATCAAAGATGANTTCCA
GCTGCTGCAAGCGCAGTATCACAGCCTGAAGCTGGAGTGCGACAAGCTGGCCAGCTGAGAAGTCAGAGATGCAGAGGCAT
TACCGTNATGTACTATGAGATGTCCTACAGGATTGAACATCGAGATGCACAAACAGGCGGAAATTGTGAAGANGCTGAAT
GGGATTTGCGCCCAGGTTCTGCCCTATTTGTCACAGGAGCATCAGCAGNAGGTCCTGGGAGCCATCGAGAGAGCCAAGCA
GGTCACGGCTCCTGAGCNTGAACTCCATCATCCGACAGCAGCTNCAGGCTCACCAGCTGTNCCAGCTGCAGGNGCTGGNC
CTGCCCCTGACACCGGTGGCTGTCGGGCTTCANCCACCGTCCCTCCCTGCAGTCAGTGCAGGCACAGGCCTGCTGTCACT
CTCTGGTCTGGGTTCTNAGACCCCACCTCTTCAAG
Sequence Type mRNA
Unitrap ID UNI21984

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 81023962..81028375 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054452 (Aes) NM_010347 amino-terminal enhancer of split Gene [Source:MGI Symbol;Acc:MGI:95806]

 
Come back to gene ENSMUSG00000054452


For any suggestions or comments, please send an email to unitrap@crg.es