Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST279548
Clone ID OST279548
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST279548
Sequence
TGAAGCTGAGAACACGGAAGGCTTCTCAGCAGTCCAGTNCAATCCAGACACAGCGCACTGCCAGAGCAAAGAGGAAATAC
TCGGAGGTTGATGATAGCTTGCCTTCAGGAGGAGAAAAACCATCAAAGAATGAAACCGGCTTATTGTCTTCAATTAAAAA
GTTCATTAAAGGAAGCACACCCAAGGAAGAGAGAGAAAATCCTTCGAAGCGGAGTAGAATTGAACGTGATATAGATAATA
ATTTAATCACATCAACACCAAGAACCGGAGAAAAGCCTGACAAACAGTTGTCTCGAGTAAGACGGAAAAGTCCAGTCAAT
GGAGAAGCTGGTAGTTATGAAATGACAAATCAACATATAAAGCAAAATGGAAAATTAGAAGATAACCCTTGCTCTGGTAG
TCCTCCGAGGACTACATTGTTGGGGACCATATTTTCGCCTGTCTTCAACTTTTTTTCACCAGCAAATAAAAATGGAACGT
C
Sequence Type mRNA
Unitrap ID UNI15164

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121794831..121804783 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033411 (Ctdspl2) NM_212450 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 Gene [Source:MGI (curated);Acc:Ctdspl2-001]

 
Come back to gene ENSMUSG00000033411


For any suggestions or comments, please send an email to unitrap@crg.es