Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST279529
Clone ID OST279529
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST279529
Sequence
ACTATTGGTCTAGAACAGACNGCCTTGNACACTCCTAACGTCAGAAGNCGGTGGGGCNNGTTGACTGAGCCCTGGCAGTC
TCCCAGTGTCAGCATGAACTCCAGGGTCCCAGCTACTCAGAGCTGGTTCAGCAGCCACCTGCCCACCACTGAGCCTGACT
TGGAGCCCGCCACTGCCGCCGAAGGCTCTACCACTGAGACCGCCACCCTCAGCCCAGAAACCACAAGCTTCAATGACACC
AGAATCCCTGATGTGGCAGGTGGTGCAGCTGGTGTGGGCACCATGCTTCTGTCTTTTGGGATCATCACAGTGATTGGCCT
GGCTGTGGCCATGGTTNTATACATCACAAGCAA
Sequence Type mRNA
Unitrap ID UNI22988

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107244602..107244922 297
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037977 (6430571L13Rik) NM_175486 RIKEN cDNA 6430571L13 gene Gene [Source:MGI Symbol;Acc:MGI:2445137]

 
Come back to gene ENSMUSG00000037977


For any suggestions or comments, please send an email to unitrap@crg.es