Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST279528
Clone ID OST279528
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST279528
Sequence
CCTCCAGGAAGGTCAGAACAACGACAAGTTCTTCACCCACCCCAAGGATGCCAGAGCCGCTGGCGGCCTACCTCTTCGTC
CACAACCACTTCTTCTACATGATGGAGCTGCTCACGGCCCTGCTCCTGCTGCTGCTGTCGCTGTGCGAGTCCCCCGCTGT
CCCCGTGCTCAAGCTGCACACTTACGTCCACGCCACGCTGGAACTCTTTGCCCTCATGGTGGTGGTATTTGAACTCTGCA
TGAAATTGCGGTGGCTGGGCTTCCACACGTTCGTCCGGCACAAACGTACCATGGTCAAGACGTCCGTCCTCGTGGGTGCA
GTTCATCGAGGCCATTGTGGTGCTGGTTCGGCAGACGTCCCACGTGCGGGTGACCCGGGCACTACGCTGCATT
Sequence Type mRNA
Unitrap ID UNI22989

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121005915..121007957 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032741 (Tpcn1) NM_145853 two pore channel 1 Gene [Source:MGI Symbol;Acc:MGI:2182472]

 
Come back to gene ENSMUSG00000032741


For any suggestions or comments, please send an email to unitrap@crg.es