Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST279369
Clone ID OST279369
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST279369
Sequence
ACTGAGGTGGGGTCTTTNAGTGAAGCGAGTATGAAGCTGCCGCAGCGCGAATCGAGGCCATGGATCCCGCCACTGTAGAA
CAGCAGGAACACTGGTTTGAAAAGGCCTTGCGGGACAAGAAAGGCTTCATCATCAAGCAGATGAAGGAGGACGGTGCCTG
TCTATTTCGGGCTGTAGCTGACCAGGTGTATGGAGACCAGGACATGCATGAGGTTGTTCGAAAGCATTGCATGGACTATC
TGATGAAGAACGCTGATTACTTCTCCAACTATGTCACAGAAGACTTCACCACCTATATCAACCGGAAGCGGAAAAACAAC
TGCCATGGCAACCACATTGAAATGCAGGCTATGGCAGAGATGTACAACCGTCCTGTGGAGGTGTATCAATATAGCACAGA
ACCTATCAACACATTCCATGGGATCCATCAAAATGAAGATGAACCCATCCGTGTCAGCTACCACCGGAATATCCACTATA
ATTCAGTGGTGAATCCTAACAAGGTTGTTCCT
Sequence Type mRNA
Unitrap ID UNI22996

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7419771..7445153 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031154 (Otud5) NM_138604 OTU domain containing 5 Gene [Source:MGI (curated);Acc:Otud5-003]

 
Come back to gene ENSMUSG00000031154


For any suggestions or comments, please send an email to unitrap@crg.es