Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC1453
Clone ID GC1453
Cell line E14Tg2A.4
Vector pFlip1
Project tigem
Note NULL

Sequence tag GC1453
Sequence
CACTCTTGGGTTTAGACTCGCCGGCCGGCCCCGCCGAGGCGGAGCGGGGCGGCTGTTG
Sequence Type mRNA
Unitrap ID UNI409

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115722266..115722323 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041740 (Rnf10) NM_016698 ring finger protein 10 Gene [Source:MGI (curated);Acc:Rnf10-002]

 
Come back to gene ENSMUSG00000041740


For any suggestions or comments, please send an email to unitrap@crg.es