Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST279262
Clone ID OST279262
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST279262
Sequence
GCCACATTCCACTGACCCCCGAGNACCAGAGGGACCAGGAAAGGCGGATTCGACGCGAGATTGCCAACAGCAACGAGCGG
AGGCGCATGCAGAGTATCAACGCGGGCTTCCAGTCCCTCAAGACCCTCATTCCCCACACAGATGGAGAGAAGCTCAGCAA
GGCAGCCATTCTCCAGCAGACAGCAGAATACATCTTCTCTCTTGAACAGGAGAAGACTAGACTCCTGCAGCAGAACACAC
AGCTCAAGCGCTTTATCCAGGAGCTGAGTGGCTCATCCCCGAAGCGGCGGCGGGCGGAAGACAAGGATGAGGGCATTGGC
TCACCCGACATCTGGGAGGATGAGAAGGCTGAGGACCTTAGGAGAGAGATGATCGAGCTGCGACAACAGCTGGACAAGGA
GCGCTCCGTGCGGATGATGCTGGAAGAGCAGGTGCGCTCCCTCGAGGCCCACATGTACCCGGAAAAACTCAAGGTGATTG
CCCAGCAGGT
Sequence Type mRNA
Unitrap ID UNI684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4549413..4552092 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005718 (Tcfap4) NM_031182 transcription factor AP4 Gene [Source:MGI Symbol;Acc:MGI:103239]

 
Come back to gene ENSMUSG00000005718


For any suggestions or comments, please send an email to unitrap@crg.es