Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST279238
Clone ID OST279238
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST279238
Sequence
AAGAATTCTGGCCAAACAAANAATNCACCCAGAGAGGNCACCTTNANAGAAATTGTTGGCTGTGAGGGAGTTTGAGTNAC
ATNTGGACAAGCTANACAACGAGAAGAAAGATCTCATCCAGAGTGACATCGCCGCTCTCCACCAGTTCTACTCCAAGTAC
CTGGAATTCCCTGACCACAGCAGTCTCGTGGTGCTCTTCGCCCAGGTTTAGCAAGCACTTATCGTCGGNCATTGTGGGTA
CCACACTGNAGCAGCCATCCAGCAGGAGAGAGCCATTTTGCTTAGTACATAGCCAGTAATACCTAAGAACGGAGTTTCCT
ACACAAAGAAGTTTACTGAAGGAAAGAAAATTTG
Sequence Type mRNA
Unitrap ID UNI17004

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 191717775..191723715 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026603 (Smyd2) NM_026796 SET and MYND domain containing 2 Gene [Source:MGI (curated);Acc:Smyd2-001]

 
Come back to gene ENSMUSG00000026603


For any suggestions or comments, please send an email to unitrap@crg.es