Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST278662
Clone ID OST278662
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST278662
Sequence
CTGAGCCCAAAATGAATATATTGAATTGCACCGCAAACGATACGGATATCGTTTGGACTACCATGAGAAAAA
Sequence Type mRNA
Unitrap ID UNI19468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97905596..97905665 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060739 (5730427N09Rik) NM_021552 RIKEN cDNA 5730427N09 gene Gene [Source:MGI Symbol;Acc:MGI:1913883]

 
Come back to gene ENSMUSG00000060739


For any suggestions or comments, please send an email to unitrap@crg.es