Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST278503
Clone ID OST278503
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST278503
Sequence
GCTGCATCGTCTGCCATCAGTGTGCAACCGGCCCCCAACGCAATGTGTGTTTGTCAAACCATGGAAGTGGGGCAGTATGG
CAAGAACGCAAGTCGGGCCGGAGACCGAGGAGTCCTCCTGGAGCCCTTCATCCATCAGGTGGGCGGGCACAGCAGCATGA
TGCGGTACGACGACCACACTGTGTGCAAACCTCTCATCTCCCGGGAACAGCGCTTCTACGAGTCACTCCCTCCCGAAATG
AAGGAATTCACCCCAGAGTACAAAGGCGTGGTTTCTGTCTGTTTTGAGGGAGACAGTGATGGTTACATCAACTTGGTAGC
CTATCCTTATGTGGAGAGTGAAACTGTAGAGCAAGATGACACACCAGAGCGGGAGCAACCTNNGNGCAAACACTCCCGCC
GGAGCCTGCATCTGG
Sequence Type mRNA
Unitrap ID UNI13623

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107926517..107934476 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032594 (Ihpk1) NM_013785 inositol hexaphosphate kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1351633]

 
Come back to gene ENSMUSG00000032594


For any suggestions or comments, please send an email to unitrap@crg.es