Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC431
Clone ID YTC431
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC431
Sequence
TAGAAGTAAAGTAATGCTAACGGTCAGCCGCTTCAATTTCAGCACCCAGCATGCCACCTTAAGATTGACCTGGATTTTAC
AAAACCTATCTGAGGTGAAAAGGGCAGTTGAAGAAGACAATTGTTGCTTTGGGACGATTGATACCTGGCTGTTATACAAG
CTCACGAAAGGTTCTTCCTACGCCACGGATTATTCAAATGCCAGCACCACTGGATTTTTTGATCCCTATGCGATGCGCTG
GAGCAGGCTCATAACCACCATGGTCTCCATCCCACTGTCTATCCTGCCTCCTGTGAAGGATACCAGCTATAATTTTGGAT
CAGTGGATGAGAAGATATTTGGCGTGCCTATACCAGTTGTTGCCTTGGTTGGTGACCAGCAGTCGGCCATGTTTGGAGAG
TGCTGCTTCGAGACGGGAGATGTGAAGCTAACCATGGGAACTGGAACATTTTTGGATATCAATACTGGAAAAAACCTTCA
GCATGTTAATGGAGGCTTTTATCCACTAATTGGATGGAAGATTGGGCAAGAACTTGTATGTTTAGCTGAAGGCAATGCAG
GAGACACGGGCACCGCCATAATGTGGGCTCAAAAATT
Sequence Type mRNA
Unitrap ID UNI5014

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96040996..96055914 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041440 (Gk5) NP_796326 glycerol kinase 5 (putative) Gene [Source:MGI (curated);Acc:Gk5-001]

 
Come back to gene ENSMUSG00000041440


For any suggestions or comments, please send an email to unitrap@crg.es