Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC436
Clone ID YTC436
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC436
Sequence
TGTCCTCTCTGCCTCTATCACACCAAATACAAACGCAACATGATCGACCACATAGTGCTGCACCGAGAAGAGCGAGTTGT
CCCCATTGAAGTGTGCCGTTCCAAACTGTCAAAATACTTGCAGGGAGTAGTTTTCCGCTGTGATAAGTGTACCTTCACCT
GCTCCAGTGACGAGAGTCTCCAGCAACACATAGAAAAGCACAATGAACTGAAACCGTACAAATGCCAGCTCTGCTACTAT
GAGACCAAGCACACGGAGGAACTGGACACTCACCTTCGGGATGAGCACAAGGTGAGCCGGAACTTTGAGCTGGTTGGCCG
GGTGAACTTGGATCAGCTGGAACAGATGAAGGAGAAGATTGAGAGTTCCAGCAGCGAGGACGAGGACAAGGACGACGAAA
TGAGCAGCAAGGCTGAGGACAGAGAGCTGATGAGATTTGCAGACCGGGGGCCTGGTGTGAACACAGAGAAGCGATTTCCA
TGTGAATTCTGTGGACGGGCGTTCTCACAGGGCTCTGAGTGGGAAAGACACGTGTTGAGA
Sequence Type mRNA
Unitrap ID UNI5015

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55064133..55092251 228
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060206 (Zfp462) NM_172867 zinc finger protein 462 Gene [Source:MGI (curated);Acc:Zfp462-001]

 
Come back to gene ENSMUSG00000060206


For any suggestions or comments, please send an email to unitrap@crg.es