Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC442
Clone ID YTC442
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC442
Sequence
GTGGAGGAACATGGCGTTGCTGGTGCGAGTCCTTAGGAACCAGACTAGCATCTCTCAGTGGGTTCCAGTATGCAGCCAAC
TGGTATCAGTGTCTCCTACCCAAAGACAGTGGAGCAGCACTTC
Sequence Type mRNA
Unitrap ID UNI5018

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155747375..155755782 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005882 (Uqcc) NM_018888 ubiquinol-cytochrome c reductase complex chaperone, CBP3 homolog (yeast) Gene [Source:MGI (curated);Acc:Uqcc-010]

 
Come back to gene ENSMUSG00000005882


For any suggestions or comments, please send an email to unitrap@crg.es